warning in e8547aef6b97c8ef: description for new allele "prp10-1(A1089V,S1097F)" does not match the existing allele with the same name "prp10-1(A1050V,S1058F)" (from session 7d409d497eb075ca) warning in b414bd2e9981203d: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in 4847e0de3cb01075: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 5bef3e6a63b5bcf4) warning in 4847e0de3cb01075: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in 1c51e41628bda782: occurs_in() not allowed for cellular_component, annotation: SPBC216.07c.1 <-> nucleolar chromatin warning in 1c51e41628bda782: occurs_in() not allowed for cellular_component, annotation: SPBC216.07c.1 <-> nucleolar chromatin warning in 1c51e41628bda782: occurs_in() not allowed for cellular_component, annotation: SPAC57A7.11.1 <-> nucleolar chromatin warning in 1c51e41628bda782: occurs_in() not allowed for cellular_component, annotation: SPAC57A7.11.1 <-> nucleolar chromatin warning in 12c854f8bde1a0cd: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in ff1e67fe7824549f: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" (from session 67f8ea3e5c1c1bfc) genotype DUMMY has no alleles warning in dcfa45e46e99ecef: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in 8589306346786b20: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 5bef3e6a63b5bcf4) warning in 714b38967995ac5b: can't find term with ID: GO:0140532 warning in 1161e0589c8a3c5a: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in 79cfb1652794d9bc: description for new allele "prp10-1(A1089V,S1097F)" does not match the existing allele with the same name "prp10-1(A1050V,S1058F)" (from session 7d409d497eb075ca) warning in f02a15cea2c40c03: can't load annotation, FYPO:0006113 is an obsolete term warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 67f8ea3e5c1c1bfc) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 5f8aff66a56b4439) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 67f8ea3e5c1c1bfc) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session 5f8aff66a56b4439) warning in 24a3853610543a99: description for new allele "prp10-1(A1089V,S1097F)" does not match the existing allele with the same name "prp10-1(A1050V,S1058F)" (from session 7d409d497eb075ca) warning in 6e903e61b25296eb: can't find term with ID: CHEBI:35176 warning in b732a3ac22de7b6e: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in 8cf2021a107c5629: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session f07cd572b2d0adcf) warning in b284d3aacd905379: in extension for 6237c6a837e9e19a-genotype-3, can't find feature with identifier: cia1 - can't find feature for: cia1 warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" does not match the existing allele with the same name "spt5-CTD-T1A(CTD-T1A)" (from session 8481a1a5bf90b23e) warning in 238989fa4ca1c956: storing feature_cvterm from SPAC664.01c.1 to histone reader activity [has_input] hht3/InitMet-/Me:(K9) - failed to store feature_cvterm: that annotation has already been stored in Chado with properties: evidence: "Inferred from Direct Assay" from session: 238989fa4ca1c956 warning in acd1a2d2ddcf29cc: description for new allele "cut12.PDswap(GILKTPGTLQIKKTVNF71ILGHKLEYNYNSHMVYI)" does not match the existing allele with the same name "cut12.PDswap(GILKTPTQIKKTVNF71ILGHKLEYNYNSHMVYI)" (from session acd1a2d2ddcf29cc) warning in 60eea6892c654dff: can't load annotation, GO:1990274 is an obsolete term