genotype DUMMY has no alleles warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in 6a434febaf336782: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session 8cf2021a107c5629) warning in f07cd572b2d0adcf: description for new allele "tor2-ts10(A1398E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1399E,F2198L)" (from session 8589306346786b20) warning in 5bef3e6a63b5bcf4: description for new allele "tor2-ts10(A1398E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1399E,F2198L)" (from session 8589306346786b20) warning in 4847e0de3cb01075: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session 8cf2021a107c5629) warning in 12c854f8bde1a0cd: description for new allele "tor2-ts10(A1398E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1399E,F2198L)" (from session 8589306346786b20) warning in 12c854f8bde1a0cd: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session 8cf2021a107c5629) warning in ff1e67fe7824549f: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" (from session 67f8ea3e5c1c1bfc) warning in 6e903e61b25296eb: can't find term with ID: CHEBI:35176 warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(CTD-T1A)" does not match the existing allele with the same name "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" (from session acd89b47e1b47f21) warning in 8481a1a5bf90b23e: description for new allele "spt5-CTD-T1A(CTD-T1A)" does not match the existing allele with the same name "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" (from session acd89b47e1b47f21) warning in b732a3ac22de7b6e: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session 8cf2021a107c5629) warning in b414bd2e9981203d: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session 8cf2021a107c5629) warning in b414bd2e9981203d: description for new allele "tor2-ts10(A1398E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1399E,F2198L)" (from session 8589306346786b20) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 67f8ea3e5c1c1bfc) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session a6782fab5fd233d0) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 67f8ea3e5c1c1bfc) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session 67f8ea3e5c1c1bfc) warning in 1161e0589c8a3c5a: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session 8cf2021a107c5629)