warning in b732a3ac22de7b6e: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in 3a3a0d9e76ed714d: description for new allele "atg43-1(atg43::kanMX4(nt49-203))" does not match the existing allele with the same name "atg43-1(49-203)" warning in 3a3a0d9e76ed714d: allele_type for new allele "atg43-1(disruption)" does not match the existing allele with the same name "atg43-1(partial_nucleotide_deletion)" warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(CTD-T1A)" does not match the existing allele with the same name "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" (from session acd89b47e1b47f21) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 59d6007b5a42a1e8) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session fcfd9a50a6a6cb53) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session 95ec493fb8fa90cf) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in 4847e0de3cb01075: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 12c854f8bde1a0cd) warning in 4847e0de3cb01075: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in dcfa45e46e99ecef: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in 0f72d4033c5d842f: description for new allele "tti2-CKO(conditional deletion)" does not match the existing allele with the same name "tti2-CKO(wild type)" (from session ddb5158a6caf4996) warning in 0f72d4033c5d842f: allele_type for new allele "tti2-CKO(other)" does not match the existing allele with the same name "tti2-CKO(wild_type)" (from session ddb5158a6caf4996) warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in 8589306346786b20: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 12c854f8bde1a0cd) warning in ff1e67fe7824549f: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in ff1e67fe7824549f: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" (from session 67f8ea3e5c1c1bfc) warning in f07cd572b2d0adcf: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in f07cd572b2d0adcf: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 12c854f8bde1a0cd) warning in c75277b83a634a8d: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in 8cf2021a107c5629: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in ef012afa9234a01e: description for new allele "rad12-502(disruption)" does not match the existing allele with the same name "rad12-502(T543I)" (from session ab4820f788afe927) warning in ef012afa9234a01e: allele_type for new allele "rad12-502(disruption)" does not match the existing allele with the same name "rad12-502(amino_acid_mutation)" (from session ab4820f788afe927) warning in 1161e0589c8a3c5a: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in 6a434febaf336782: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in 6a434febaf336782: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 12c854f8bde1a0cd) warning in 66d1d84a63cd8a3e: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) genotype DUMMY has no alleles warning in 5bef3e6a63b5bcf4: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 12c854f8bde1a0cd) warning in 8481a1a5bf90b23e: description for new allele "spt5-CTD-T1A(CTD-T1A)" does not match the existing allele with the same name "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" (from session acd89b47e1b47f21) warning in af39cc71da933c2d: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in b414bd2e9981203d: description for new allele "tor2-ts6(S550P,K711M)" does not match the existing allele with the same name "tor2-ts6(S550P,K710M)" (from session 12c854f8bde1a0cd) warning in b414bd2e9981203d: description for new allele "tor2-ts10(A1399E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1398E,F2198L)" (from session 12c854f8bde1a0cd)