warning in a206afb9651e2886: can't find term with ID: GO:1903486 warning in 6788fbad2542709a: description for new allele "etd1+(Overexpression of GFP-etd1)" does not match the existing allele with the same name "etd1+(wild type)" (from session 3520ae1d8f10669a) warning in ddb5158a6caf4996: description for new allele "tti2-CKO(wild type)" does not match the existing allele with the same name "tti2-CKO(conditional deletion)" (from session 0f72d4033c5d842f) warning in ddb5158a6caf4996: allele_type for new allele "tti2-CKO(wild_type)" does not match the existing allele with the same name "tti2-CKO(other)" (from session 0f72d4033c5d842f) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 59bf3609c95bb937) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session fcfd9a50a6a6cb53) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session 59bf3609c95bb937) warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in b414bd2e9981203d: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session b414bd2e9981203d) warning in b414bd2e9981203d: description for new allele "tor2-ts10(A1398E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1399E,F2198L)" (from session 8589306346786b20) warning in 20a419e583ad61e6: description for new allele "mcm4-tstd(Ub-DHFRts-mcm4)" does not match the existing allele with the same name "mcm4-tstd(cdc21-M68-degron(DHFR))" (from session 37237b530ab38bc9) warning in 3a3a0d9e76ed714d: description for new allele "atg43-1(atg43::kanMX4(nt49-203))" does not match the existing allele with the same name "atg43-1(49-203)" warning in 3a3a0d9e76ed714d: allele_type for new allele "atg43-1(disruption)" does not match the existing allele with the same name "atg43-1(partial_nucleotide_deletion)" warning in 12c854f8bde1a0cd: description for new allele "tor2-ts10(A1398E,F2198L)" does not match the existing allele with the same name "tor2-ts10(A1399E,F2198L)" (from session 8589306346786b20) warning in 12c854f8bde1a0cd: description for new allele "tor2-ts6(S550P,K710M)" does not match the existing allele with the same name "tor2-ts6(S550P,K711M)" (from session b414bd2e9981203d) warning in af39cc71da933c2d: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in 66d1d84a63cd8a3e: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in d735a52f09029ebf: in annotation extension for PomBase-genotype-5465, can't parse identifier in "has_penetrance(low)" warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in ab7d71d62a2030e3: description for new allele "gar2::ura4+(gar2::ura4)" does not match the existing allele with the same name "gar2::ura4+(gar2::ura4+)" (from session cbaaa61496b71364) genotype DUMMY has no alleles warning in 56ce08f89dc9d46c: description for new allele "mcm4-tstd(Ub-DHFRts-mcm4)" does not match the existing allele with the same name "mcm4-tstd(cdc21-M68-degron(DHFR))" (from session 37237b530ab38bc9) warning in 2d8412a36a34689a: can't load annotation, GO:0061912 is an obsolete term warning in 7097a362b55929af: description for new allele "mcm4-tstd(Ub-DHFRts-mcm4)" does not match the existing allele with the same name "mcm4-tstd(cdc21-M68-degron(DHFR))" (from session 37237b530ab38bc9) warning in 4488533ca5f8fdc3: description for new allele "cdc23-tstd(fusion;C239Y,AA424::TEV,degron)" does not match the existing allele with the same name "cdc23-tstd(Ub-DHFRts-cdc23-C239Y)" (from session 37237b530ab38bc9) warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" does not match the existing allele with the same name "spt5-CTD-T1A(CTD-T1A)" (from session 8481a1a5bf90b23e) warning in ff1e67fe7824549f: description for new allele "rpb1-CTD-Y1F(CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" (from session fcfd9a50a6a6cb53) warning in ff1e67fe7824549f: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" (from session 66d1d84a63cd8a3e) warning in f5403fffd3ecaf81: can't find term with ID: GO:0061407