warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 614edec10b9e3e6a: can't load annotation, FYPO:0003604 is an obsolete term
warning in 20128de7e05e2f96: can't load annotation, FYPO:0003604 is an obsolete term
warning in 20128de7e05e2f96: can't load annotation, FYPO:0003604 is an obsolete term
warning in 6186ba197a53e798: allele_type for new allele "spt5-CTD-T1A(7)(amino_acid_insertion_and_mutation)" does not match the existing allele with the same name "spt5-CTD-T1A(7)(amino_acid_insertion_and_deletion)" (from session 8481a1a5bf90b23e)
warning in b42a7324f08b6a24: can't find term with ID: GO:1904789
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4671 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBP4G3.02 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4671 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBC8E4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4671 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBC1703.13c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from ab5171b90f5cef1d-genotype-5 (ssu72-C13S) to decreased RNA level [assayed_transcript] PomBase:SPBC1703.13c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in acd89b47e1b47f21: description for new allele "spt5-CTD-T1A(T818A,T827A,T836A,T845A,T854A,T863A,T872A,T881A,T890A,T899A,T908A,T917A,T925A,T939A,T952A,T963A,T971A)" does not match the existing allele with the same name "spt5-CTD-T1A(CTD-T1A)" (from session 8481a1a5bf90b23e)
warning in 67f8ea3e5c1c1bfc: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" (from session ff1e67fe7824549f)
warning in 995720e27a54ba1b: can't load annotation, FYPO:0003604 is an obsolete term
warning in e13e49a2df6b7722: can't load annotation, FYPO:0003604 is an obsolete term
warning in e13e49a2df6b7722: can't load annotation, FYPO:0003604 is an obsolete term
warning in e13e49a2df6b7722: can't load annotation, FYPO:0003604 is an obsolete term
warning in db9b5a7b5f36c25c: description for new allele "rec8(TEV)(rec8-AA341::TEV)" does not match the existing allele with the same name "rec8(TEV)(rec8(1-361)-(ENLYFQGAS)-rec8(362-561))" (from session db9b5a7b5f36c25c)
warning in a6d8f45c20c2227d: in extension for a6d8f45c20c2227d-genotype-6, can't find feature with identifier: rpn15 - can't find feature for: rpn15
warning in a6d8f45c20c2227d: in extension for a6d8f45c20c2227d-genotype-7, can't find feature with identifier: rpn15 - can't find feature for: rpn15
warning in a6d8f45c20c2227d: in extension for a6d8f45c20c2227d-genotype-8, can't find feature with identifier: rpn15 - can't find feature for: rpn15
warning in a6d8f45c20c2227d: in extension for a6d8f45c20c2227d-genotype-9, can't find feature with identifier: rpn15 - can't find feature for: rpn15
warning in a6d8f45c20c2227d: in extension for a6d8f45c20c2227d-genotype-9, can't find feature with identifier: rpn15 - can't find feature for: rpn15
warning in ab08277b7b3bc9c4: description for new allele "cdc13-RLuc(cdc13-RLuc)" does not match the existing allele with the same name "cdc13-RLuc(hypomorph)" (from session ab08277b7b3bc9c4)
warning in ab08277b7b3bc9c4: allele_type for new allele "cdc13-RLuc(fusion_or_chimera)" does not match the existing allele with the same name "cdc13-RLuc(other)" (from session ab08277b7b3bc9c4)
warning in 06e82eaa6f509bdb: can't find term with ID: CHEBI:45979
warning in ed7f95ec599f51aa: can't load annotation, FYPO:0003604 is an obsolete term
warning in ed7f95ec599f51aa: can't load annotation, FYPO:0003604 is an obsolete term
warning in e040917969e21e31: allele_type for new allele "ras1+(wild_type)" does not match the existing allele with the same name "ras1+(amino_acid_mutation)" (from session 089bad866432ef28)
warning in 7519fc48320b66a8: can't load annotation, FYPO:0003604 is an obsolete term
warning in 66d1d84a63cd8a3e: allele_type for new allele "rpb1-CTD-P3A(r2-r29-2)(amino_acid_insertion_and_mutation)" does not match the existing allele with the same name "rpb1-CTD-P3A(r2-r29-2)(amino_acid_mutation)" (from session ff1e67fe7824549f)
warning in 2a8be2bb0239204b: description for new allele "plo1-TEVAA341(tev-site@AA341)" does not match the existing allele with the same name "plo1-TEVAA341(plo1(1-341)-(ENLYFQGAS)-plo1(342-405)-(ENLYFQGAS)-plo1(406-683))" (from session e13e49a2df6b7722)
warning in e3188b7c6757274d: description for new allele "loz1+(a Loz1-GFP fusion protein that is expressed from a derivative of the pgk1 promoter containing a deletion in the TATA box.)" does not match the existing allele with the same name "loz1+(wild type)"
warning in 5f8aff66a56b4439: storing feature_cvterm from a2ee596ebb2b3e9a-genotype-1 (asp1-D333A) to decreased RNA level [assayed_transcript] PomBase:SPBP4G3.02 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000137", evidence: "transcript expression level evidence"  from session: 5f8aff66a56b4439
warning in 5f8aff66a56b4439: storing feature_cvterm from a2ee596ebb2b3e9a-genotype-1 (asp1-D333A) to decreased RNA level [assayed_transcript] PomBase:SPBC8E4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000137", evidence: "transcript expression level evidence"  from session: 5f8aff66a56b4439
warning in a206afb9651e2886: can't load annotation, GO:1903486 is an obsolete term
warning in a206afb9651e2886: can't find term with ID: GO:1903486
warning in a206afb9651e2886: can't load annotation, GO:1903486 is an obsolete term
warning in cbaaa61496b71364: description for new allele "gar2::ura4+(gar2::ura4+)" does not match the existing allele with the same name "gar2::ura4+(Gar2 aa 1-163,Ura4 aa 1-39)" (from session ab7d71d62a2030e3)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(T1101TCATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R3(nt 813-828 duplicated; translated product has aa 1-179 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R3(A827AATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R3(other)" does not match the existing allele with the same name "cdc27-R3(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in f7e61f1bbab2a27b: description for new allele "myo2-ST(chimera+myp2-aa1923-2104)" does not match the existing allele with the same name "myo2-ST(myo2-myp2(1923-2104))" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: description for new allele "myo2-LT(chimera + myp2-aa1622-2104)" does not match the existing allele with the same name "myo2-LT(myo2-myp2(1622-2104))" (from session f7e61f1bbab2a27b)
warning in 803cfb382ebb41c6: allele_type for new allele "ras1+(wild_type)" does not match the existing allele with the same name "ras1+(amino_acid_mutation)" (from session 089bad866432ef28)
warning in a64b97197e845b5b: allele_type for new allele "ras1+(wild_type)" does not match the existing allele with the same name "ras1+(amino_acid_mutation)" (from session 089bad866432ef28)
genotype DUMMY has no alleles
warning in 7803457eba12e494: description for new allele "top2-12KR(K1228,K1254,K1255,K1269,K1280,K1284,K1292,K1309,K1376,K1398,K1399,K1437)" does not match the existing allele with the same name "top2-12KR(K1228R,K1254R,K1255R,K1269R,K1280R,K1284R,K1292R,K1309R,K1376R,K1398R,K1399R,K1437R)" (from session 7803457eba12e494)
warning in 6bede5008acef48c: storing feature_cvterm from 0e41810c76efe2f3-genotype-6 (mis18-262) to decreased protein localization to kinetochore during vegetative growth [assayed_using] PomBase:SPAC1687.20c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000004", evidence: "microscopy evidence"  from session: 6bede5008acef48c
warning in 9917fbd53b49c243: storing feature_cvterm from 9917fbd53b49c243-genotype-29 (sin1-L357A,F361A) to decreased protein phosphorylation [assayed_using] PomBase:SPCC24B10.07 - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000126", evidence: "Western blot assay"  from session: 9917fbd53b49c243
warning in 9917fbd53b49c243: storing feature_cvterm from 9917fbd53b49c243-genotype-29 (sin1-L357A,F361A) to normal protein-protein interaction [assayed_using] PomBase:SPBC30D10.10c [assayed_using] PomBase:SPAPYUG7.02c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000126", evidence: "Co-immunoprecipitation experiment"  from session: 9917fbd53b49c243
warning in 59bf3609c95bb937: allele_type for new allele "nc-pho1-dual-PAS-mut(amino_acid_mutation)" does not match the existing allele with the same name "nc-pho1-dual-PAS-mut(nucleotide_mutation)" (from session ab5171b90f5cef1d)
warning in 59bf3609c95bb937: description for new allele "nc-pho1-DSR(TTAAA-89-CGCGC,TTAAA-96-GCCCG,TTAAA-103-CGCGC,T399C,A401G,C404T,T413C,A415G,A416G,C418T)" does not match the existing allele with the same name "nc-pho1-DSR(DSR domain mutated)" (from session 59bf3609c95bb937)
warning in 37237b530ab38bc9: description for new allele "cdc23-tstd(Ub-DHFRts-cdc23-C239Y)" does not match the existing allele with the same name "cdc23-tstd(fusion;C239Y,AA424::TEV,degron)" (from session 4488533ca5f8fdc3)
warning in 37237b530ab38bc9: description for new allele "mcm4-tstd(cdc21-M68-degron(DHFR))" does not match the existing allele with the same name "mcm4-tstd(Ub-DHFRts-mcm4)" (from session 56ce08f89dc9d46c)
warning in 6e9c92a7382e9127: description for new allele "cdc18-46(E521A,D524A)" does not match the existing allele with the same name "cdc18-46(E521A,Q334A)"
warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-Y1F(rpb1-CTD-Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session ff1e67fe7824549f)
warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-T4A(rpb1-CTD-T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session ab5171b90f5cef1d)
warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S2A(rpb1-CTD-S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 33497d588756c658)
warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(rpb1-CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A(CTD-S7A)" (from session 4228fd893e7a1a88)
warning in 363d7c14c0239ceb: can't load annotation, FYPO:0003604 is an obsolete term
warning in 216f4dec12ef6153: description for new allele "ndc80-GFP(ndc80-GFP)" does not match the existing allele with the same name "ndc80-GFP(ndc80 tagged with GFP)" (from session fe7a0f32d4e76d5d)
warning in 774b7f1a9f489629: description for new allele "cdc18-46(E521A,D524A)" does not match the existing allele with the same name "cdc18-46(E521A,Q334A)" (from session 6e9c92a7382e9127)
warning in 0b0990bc7e9460b7: description for new allele "rng2-Ns(301-1489)" does not match the existing allele with the same name "rng2-Ns(1-399)" (from session d1ca5d873c81c5fa)
warning in 0b0990bc7e9460b7: description for new allele "rng2-Ns(301-1489)" does not match the existing allele with the same name "rng2-Ns(1-399)" (from session d1ca5d873c81c5fa)