warning in a4ab4922ffecbd92: can't load annotation, GO:1903478 is an obsolete term
warning in 66d1d84a63cd8a3e: description for new allele "rpb1-CTD-S5.S5A(-CTD-S5.S5A(alternating))" does not match the existing allele with the same name "rpb1-CTD-S5.S5A(CTD-S5.S5A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 0d638c12aef4db07: description for new allele "cgs2-2(1366-T)" does not match the existing allele with the same name "cgs2-2(frameshifted allele)" (from session 0d638c12aef4db07)
warning in 0d638c12aef4db07: allele_type for new allele "cgs2-2(nucleotide_insertion)" does not match the existing allele with the same name "cgs2-2(other)" (from session 0d638c12aef4db07)
warning in 95ec493fb8fa90cf: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTD-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)
warning in 8481a1a5bf90b23e: description for new allele "spt5(T1E)7(CTD-T1E)" does not match the existing allele with the same name "spt5(T1E)7(T1E mutations within the CTR)" (from session 8481a1a5bf90b23e)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTR-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)
warning in 2a8be2bb0239204b: description for new allele "plo1-TEVAA341(tev-site@AA341)" does not match the existing allele with the same name "plo1-TEVAA341(TEVAA341)" (from session 2a8be2bb0239204b)
warning in a6782fab5fd233d0: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 33497d588756c658: description for new allele "rpb1-CTD-S2A((CTD)S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(nt 930-1102 duplicated; translated product has aa 1-271 plus 24 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R5(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R5(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(nt 930-1102 duplicated; translated product has aa 1-271 plus 24 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R5(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R5(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R39(A827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(nt 807-828 duplicated; translated product has aa 1-179 plus 4 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R39(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R39(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R39(A827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(nt 807-828 duplicated; translated product has aa 1-179 plus 4 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R39(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R39(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R3(nt 813-828 duplicated; translated product has aa 1-179 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R3(A827-ATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R3(other)" does not match the existing allele with the same name "cdc27-R3(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in acd89b47e1b47f21: description for new allele "rpb1-CTD-T4A(5-29)(CTD-T4A(5-29))" does not match the existing allele with the same name "rpb1-CTD-T4A(5-29)(CTD-T4A(5,29))" (from session a93df4140a4b1e4c)
warning in 1edc814df6ff1176: can't find term with ID: GO:0035103
warning in fd7d19b1aed14f7c: in annotation extension for fd7d19b1aed14f7c-genotype-1, can't parse identifier in "assayed_using(SPAC17G6.02c.2)"
warning in fd7d19b1aed14f7c: in annotation extension for PomBase-genotype-3318, can't parse identifier in "assayed_using(SPAC17G6.02c.2)"
warning in fd7d19b1aed14f7c: in annotation extension for fd7d19b1aed14f7c-genotype-3, can't parse identifier in "assayed_using(SPAC17G6.02c.2)"
warning in 5f8aff66a56b4439: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 169c0f8873eee853: can't load annotation, GO:0070219 is an obsolete term
genotype DUMMY has no alleles
warning in 92cda7cb8c6c7a8c: can't load annotation, GO:1990521 is an obsolete term
warning in 37237b530ab38bc9: description for new allele "cdc23-tstd(degron(DHFR),C239Y)" does not match the existing allele with the same name "cdc23-tstd(fusion;C239Y,AA424::TEV,degron)" (from session 4488533ca5f8fdc3)
warning in 37237b530ab38bc9: description for new allele "mcm4-tstd(cdc21-M68-degron(DHFR))" does not match the existing allele with the same name "mcm4-tstd(N-terminus of Mcm4/cdc21-M68 fused to DHFR degron)" (from session 20a419e583ad61e6)
warning in bad7d44a253000ca: description for new allele "rpb1-CTD-S7A(5-29)(rpb1-CTD-S7A(5-29))" does not match the existing allele with the same name "rpb1-CTD-S7A(5-29)(CTD-S7A(5-29))" (from session a93df4140a4b1e4c)
warning in 219e86a87274fe5f: description for new allele "cgs2-2(T1366-T)" does not match the existing allele with the same name "cgs2-2(frameshifted allele)" (from session 0d638c12aef4db07)
warning in 219e86a87274fe5f: allele_type for new allele "cgs2-2(nucleotide_insertion)" does not match the existing allele with the same name "cgs2-2(other)" (from session 0d638c12aef4db07)
warning in f7e61f1bbab2a27b: description for new allele "myo2-ST(chimera+myp2-aa1923-2104)" does not match the existing allele with the same name "myo2-ST(+myp2-aa1923-2104)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: allele_type for new allele "myo2-ST(other)" does not match the existing allele with the same name "myo2-ST(amino_acid_insertion)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: description for new allele "myo2-LT(chimera + myp2-aa1622-2104)" does not match the existing allele with the same name "myo2-LT(+ myp2-aa1622-2104)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: allele_type for new allele "myo2-LT(other)" does not match the existing allele with the same name "myo2-LT(amino_acid_insertion)" (from session f7e61f1bbab2a27b)
warning in 85219fa3fd50b9ee: can't load annotation, GO:1903478 is an obsolete term
warning in 85219fa3fd50b9ee: can't find term with ID: GO:1903478
warning in 85219fa3fd50b9ee: can't load annotation, GO:1903478 is an obsolete term
warning in 85219fa3fd50b9ee: can't load annotation, GO:1903478 is an obsolete term
warning in 85219fa3fd50b9ee: can't find term with ID: GO:1903478
warning in 216f4dec12ef6153: description for new allele "ndc80-GFP(GFP-C)" does not match the existing allele with the same name "ndc80-GFP(ndc80 tagged with GFP)" (from session fe7a0f32d4e76d5d)
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4654 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBC8E4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000005,FYECO:0000137", evidence: "transcript expression level evidence"  from session: ff1e67fe7824549f
warning in ff1e67fe7824549f: storing feature_cvterm from PomBase-genotype-4654 (pin1delta) to decreased RNA level [assayed_transcript] PomBase:SPBC1703.13c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "transcript expression level evidence", condition: "FYECO:0000005,FYECO:0000137"  from session: ff1e67fe7824549f
warning in 4927cddae28a3185: allele_type for new allele "sid2-as4(amino_acid_mutation)" does not match the existing allele with the same name "sid2-as4(amino_acid_insertion_and_mutation)" (from session acd1a2d2ddcf29cc)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-S2A((CTD)S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-P3.P3A((CTD)P3A(alternating))" does not match the existing allele with the same name "rpb1-CTD-P3.P3A(CTD-P3.P3A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-P6.P6A((CTD)P6A(alternating))" does not match the existing allele with the same name "rpb1-CTD-P6.P6A(CTD-P6.P6A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-S5.S5A((CTD)S5A(alternating))" does not match the existing allele with the same name "rpb1-CTD-S5.S5A(CTD-S5.S5A(alternating))" (from session 66d1d84a63cd8a3e)
warning in 67f8ea3e5c1c1bfc: description for new allele "rpb1-CTD-Y1F((CTD)Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 66d1d84a63cd8a3e)
warning in e58982138a6526c3: allele_type for new allele "kin1deltaKA1(partial_nucleotide_deletion)" does not match the existing allele with the same name "kin1deltaKA1(partial_amino_acid_deletion)" (from session e58982138a6526c3)
warning in fcfd9a50a6a6cb53: description for new allele "rpb1-CTD-S7A(CTD-S7A)" does not match the existing allele with the same name "rpb1-CTD-S7A((CTD)S7A)" (from session 5f8aff66a56b4439)
warning in fcfd9a50a6a6cb53: description for new allele "sds21-deltaC(1-301)" does not match the existing allele with the same name "sds21-deltaC(Sds21-(1-301))" (from session fcfd9a50a6a6cb53)
warning in 0b0990bc7e9460b7: description for new allele "rng2-Ns(301-1489)" does not match the existing allele with the same name "rng2-Ns(1-399)" (from session d1ca5d873c81c5fa)
warning in 0b0990bc7e9460b7: description for new allele "rng2-Ns(301-1489)" does not match the existing allele with the same name "rng2-Ns(1-399)" (from session d1ca5d873c81c5fa)
warning in 0b0990bc7e9460b7: can't load annotation, GO:1903478 is an obsolete term
warning in db9b5a7b5f36c25c: description for new allele "rec8(TEV)(rec8-AA341::TEV)" does not match the existing allele with the same name "rec8(TEV)(rec8-AA362::TEV)" (from session db9b5a7b5f36c25c)
warning in af39cc71da933c2d: description for new allele "rpb1-CTD-Y1F((CTD)Y1F)" does not match the existing allele with the same name "rpb1-CTD-Y1F(CTD-Y1F)" (from session 66d1d84a63cd8a3e)
warning in af39cc71da933c2d: description for new allele "rpb1-CTD-S2A((CTD)S2A)" does not match the existing allele with the same name "rpb1-CTD-S2A(CTD-S2A)" (from session 66d1d84a63cd8a3e)
warning in af39cc71da933c2d: description for new allele "rpb1-CTD-T4A((CTD)T4A)" does not match the existing allele with the same name "rpb1-CTD-T4A(CTD-T4A)" (from session 66d1d84a63cd8a3e)
warning in c757e60bdb79c5cb: in annotation extension for c757e60bdb79c5cb-genotype-1, can't parse identifier in "assayed_using(SPNCRNA.574)"
warning in 089bad866432ef28: allele_type for new allele "ras1+(amino_acid_mutation)" does not match the existing allele with the same name "ras1+(wild_type)" (from session a64b97197e845b5b)
warning in 7c7509b7ad78573d: in annotation extension for SPCC825.04c.1, can't parse identifier in "has_input(hta3)"