warning in 8de8896718b55bd8: storing feature_cvterm from PomBase-genotype-581 to normal protein localization to site of mechanical stress [assayed_protein] PomBase:SPBC30B4.01c - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Microscopy"  from session: 8de8896718b55bd8
warning in f7e61f1bbab2a27b: description for new allele "myo2-ST(chimera+myp2-aa1923-2104)" does not match the existing allele with the same name "myo2-ST(+myp2-aa1923-2104)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: allele_type for new allele "myo2-ST(other)" does not match the existing allele with the same name "myo2-ST(amino_acid_insertion)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: description for new allele "myo2-LT(chimera + myp2-aa1622-2104)" does not match the existing allele with the same name "myo2-LT(+ myp2-aa1622-2104)" (from session f7e61f1bbab2a27b)
warning in f7e61f1bbab2a27b: allele_type for new allele "myo2-LT(other)" does not match the existing allele with the same name "myo2-LT(amino_acid_insertion)" (from session f7e61f1bbab2a27b)
warning in 2a8be2bb0239204b: description for new allele "plo1-TEVAA341(tev-site@AA341)" does not match the existing allele with the same name "plo1-TEVAA341(TEVAA341)" (from session e13e49a2df6b7722)
warning in 2a8be2bb0239204b: description for new allele "plo1 fusion (Cnp3)(Plo1 centromere tethered)" does not match the existing allele with the same name "plo1 fusion (Cnp3)(Plo1-centromere tethered)" (from session 2a8be2bb0239204b)
warning in 82c72ac61a6cf9b2: allele_type for new allele "cdc1-E2(other)" does not match the existing allele with the same name "cdc1-E2(amino_acid_insertion_and_deletion)" (from session 82c72ac61a6cf9b2)
warning in 1f46f7473f4ec0a4: can't load annotation, GO:0030173 is an obsolete term
warning in 7d2c05ef7277f909: description for new allele "cnp3C-TEV(protease inactivated)" does not match the existing allele with the same name "cnp3C-TEV(cnp3C-TEV)" (from session 2a8be2bb0239204b)
warning in 37237b530ab38bc9: description for new allele "cdc23-tstd(degron(DHFR),C239Y)" does not match the existing allele with the same name "cdc23-tstd(fusion;C239Y,AA424::TEV,degron)" (from session 4488533ca5f8fdc3)
warning in f0d230c2ef37468d: storing feature_cvterm from SPAC1093.04c.1 to CTP:tRNA cytidylyltransferase activity [part_of] tRNA 3'-terminal CCA addition - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  evidence: "Inferred from Direct Assay"  from session: f0d230c2ef37468d
warning in 27524319ad84c25c: storing feature_cvterm from 27524319ad84c25c-genotype-76 to abnormal colony morphology [has_severity] high - failed to store feature_cvterm: that annotation has already been stored in Chado with properties:  condition: "FYECO:0000229", evidence: "Microscopy"  from session: 27524319ad84c25c
warning in e976a54955ad43a4: description for new allele "cdc27-R39(827-TCGACAATCGATAAGACTGACA)" does not match the existing allele with the same name "cdc27-R39(nt 807-828 duplicated; translated product has aa 1-179 plus 4 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R39(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R39(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R22(782-C)" does not match the existing allele with the same name "cdc27-R22(nt C inserted after 782; translated product has aa 1-164 plus 12 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R22(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R22(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R5(1101-CATAAAGAAAAGGAGCCTCTCTTGCCAAAGGAGGAGAAGTTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAGATGAATCAGTATCTACCACTAGCGTTCACGATTCTGAAGATGATAATTTAGATTCTAATAATTTCCAATTGGAAAT)" does not match the existing allele with the same name "cdc27-R5(nt 930-1102 duplicated; translated product has aa 1-271 plus 24 aa from different reading frame)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R5(nucleotide_insertion)" does not match the existing allele with the same name "cdc27-R5(other)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R40(nt 968-1025 duplicated; translated product has aa 1-245 plus 5 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R40(1025-TTGTCTGAGCAAGCAAAGAGAGAGCGCGATGATCTGAAAAATATTATGCAGCTAGAAG)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R40(other)" does not match the existing allele with the same name "cdc27-R40(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R3(nt 813-828 duplicated; translated product has aa 1-179 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R3(827-ATCGATAAGACTGACA)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R3(other)" does not match the existing allele with the same name "cdc27-R3(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: description for new allele "cdc27-R25(nt 694-814 duplicated; translated product has aa 1-175 plus 2 aa from different reading frame)" does not match the existing allele with the same name "cdc27-R25(814-GTTGTTTGACATTCGATCCTTCCGTCTTCGGAAGACTAACTTATTGTAGCCTCGTGTTTTGAAAAAGGCACCTTCAACTCATTCCCCCCAATTATCTGTTCCCTCAAAGACATCGACAATC)" (from session e976a54955ad43a4)
warning in e976a54955ad43a4: allele_type for new allele "cdc27-R25(other)" does not match the existing allele with the same name "cdc27-R25(nucleotide_insertion)" (from session e976a54955ad43a4)
warning in 28c85bd1757a57ff: description for new allele "cut2-EA2(D127A,129E)" does not match the existing allele with the same name "cut2-EA2(D122E,E124A)" (from session 310b16bb1a103044)
warning in 20a419e583ad61e6: description for new allele "mcm4-tstd(N-terminus of Mcm4/cdc21-M68 fused to DHFR degron)" does not match the existing allele with the same name "mcm4-tstd(cdc21-M68-degron(DHFR))" (from session 37237b530ab38bc9)
genotype DUMMY has no alleles
warning in db9b5a7b5f36c25c: description for new allele "rec8(TEV)(rec8-AA341::TEV)" does not match the existing allele with the same name "rec8(TEV)(rec8-AA362::TEV)" (from session db9b5a7b5f36c25c)
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 06a0bcdb548ec92c: some data from annotation isn't used: with_gene_id
warning in 56ce08f89dc9d46c: description for new allele "mcm4-tstd(N-terminus of Mcm4/cdc21-M68 fused to DHFR degron)" does not match the existing allele with the same name "mcm4-tstd(cdc21-M68-degron(DHFR))" (from session 37237b530ab38bc9)
warning in 7097a362b55929af: description for new allele "mcm4-tstd(N-terminus of Mcm4/cdc21-M68 fused to DHFR degron)" does not match the existing allele with the same name "mcm4-tstd(cdc21-M68-degron(DHFR))" (from session 37237b530ab38bc9)
warning in 216f4dec12ef6153: description for new allele "ndc80-GFP(GFP-C)" does not match the existing allele with the same name "ndc80-GFP(ndc80 tagged with GFP)" (from session fe7a0f32d4e76d5d)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTD-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)
warning in 8481a1a5bf90b23e: description for new allele "spt5(T1E)7(CTD-T1E)" does not match the existing allele with the same name "spt5(T1E)7(T1E mutations within the CTR)" (from session 8481a1a5bf90b23e)
warning in 8481a1a5bf90b23e: description for new allele "spt5-(T1A)7(CTR-T1A)" does not match the existing allele with the same name "spt5-(T1A)7(T1A mutations within the CTR)" (from session 6186ba197a53e798)