Last updated: 2025-03-13 429297 annotations 4738 curated publications
Contact curators ...
Ontology term: altered level of substance in cell during nitrogen starvation (FYPO:0004139)
Definition Parents
A cell phenotype in which the amount of a specific substance measured in a cell that is subject to nitrogen starvation differs from normal.
External links: BioPortal
Single locus phenotype annotations for FYPO:0004139 and its descendants
Cell
Show details ...
Filters:
+ decreased cellular glutathione level during nitrogen starvation
pap1Δ
+ decreased cellular superoxide level during nitrogen starvation
atg43-ΔAIM(Y28A,I31A aa) ,   atg7Δ
+ decreased level of regulation of mitotic cell cycle gene mRNA during nitrogen starvation
ssp2Δ
+ decreased level of regulation of sexual differentiation gene mRNA during nitrogen starvation
ssp2Δ ,   tor2+[Overexpression]
lsg1Δ affecting ste11
rpb1-CTD-S2A(r1-r12)Δ(r13-r29)(CTD-S2A(r1-r12)delta(r13-r29)) affecting ste11
rpb1-CTD-S2A(r5-r29)S7A(r5-r29)(aa) affecting ste11
rpb1-S2A(r5-r29)(CTD-S2A(r5-r29)) affecting ste11
+ decreased protein level during cellular response to nitrogen starvation
atf1Δ affecting mei2
ggt1--156--421((-421)-(-156)) affecting ggt1
nam1-1(T916G,T957G,T965G,T1112G,T1278G,T1288G,T1305G,T1330G nt) affecting byr2
pap1Δ affecting atf1 , bir1 , ggt2 , mpr1 , rad9
rst2Δ affecting mug14
spo14-B221(T1161A nt) affecting spo14
ssp2Δ affecting ste11
sty1-989(Q169*) affecting cdc13 , rum1
tor2+[Overexpression] affecting ste11
vam6-532(splice site mutant) affecting rum1
vps11-319(W324*) affecting rum1
wis1-558(G461D aa) affecting cdc13 , rum1
wis1-982(F307S aa) affecting cdc13 , rum1
wis1Δ affecting mei2
ypt5-909(C209R aa) affecting rum1
+ decreased RNA level during cellular response to pheromone and nitrogen starvation
map1Δ affecting mam2 , mam3 , sxa2
+ decreased RNA level during nitrogen starvation
ste20Δ
ash2Δ affecting mam2 , map3 , mei2 , spk1
atf1::ura4(disruption) affecting ste11
atf1Δ affecting cgs2 , ste11
atg11Δ affecting ste11
byr1Δ affecting rgs1
byr2Δ affecting mam2 , mfm1 , mfm2 , mfm3 , rgs1
cgs1-1(unknown) affecting mei2
cgs1::ura4(disruption)[Null] affecting ste11
cgs1Δ affecting ste11
cgs2-p.CRE-mut(C(-68)A,G(-67)T) affecting cgs2 , ste11
fhl1Δ affecting ste11
fkh2-S462E(aa) affecting ste11
fkh2-T314E(aa) affecting ste11
fkh2Δ affecting ste11
gad8Δ affecting mei2 , rum1 , ste11
gpa1Δ affecting mam2 , mfm1 , mfm2 , mfm3
igo1-S64A(aa) affecting mei2 , ste11
igo1Δ affecting mei2 , ste11
isp6Δ affecting ste11
map1-mutant(unknown) affecting mat2-Pi
mat2-Pc-(unknown) affecting mfm1 , mfm2 , mfm3
mei4Δ affecting mes1 , ste11
mip1-15(1-173 Δaa)[Overexpression] affecting mat2-Pc , mat2-Pi
msa1+[Overexpression] affecting mam2 , mei2 , ste11
nam1-1(T916G,T957G,T965G,T1112G,T1278G,T1288G,T1305G,T1330G nt) affecting byr2
ndk1-dn(C116Y aa)[Overexpression] affecting mat2-Pc , mat2-Pi , sxa2
npr2Δ affecting isp5
pac1+[Overexpression] affecting mei2
pap1Δ affecting atf1 , mpr1 , pdi3 , rad9
par1Δ affecting mei2
pat1-114(V155G,P219S,L291F aa) affecting ste11
pcr1Δ affecting cgs2 , ste11
ppb1Δ affecting ppb1
ppk18Δ affecting mei2 , ste11
prr1::ura4(disruption)[Null] affecting mam2
prr1Δ affecting ste11
ras1Δ affecting mat1-Mi , mat2-Pi
rcd1Δ affecting ste11
reb1Δ affecting srw1
rhn1Δ affecting ste11
rpb1-CTD-S2A(aa) affecting mei2 , ste11
rst2Δ affecting ste11
sme2-3'(1-507 Δnt) affecting mei4 , ssm4
spk1Δ affecting mam2 , mfm1 , mfm2 , mfm3
spt8Δ affecting mei2 , ste11
srw1-MutPste9(AAAGTGCATTACCCTTCCCGGTTTCTC(-198)CCCGGTACCGCAAAGGAAATTGGGAGC) affecting srw1
ssp2Δ affecting mei2 , ste11
ste11-D5'-UTR((-2141)-(-4)) affecting ste11
ste11-Mb2(CCC(-2376)TGA) affecting ste11
ste11-mutant(unknown) affecting byr2
ste11-TR1-box(G149T nt) affecting ste11
ste11Δ affecting ecl1 , esc1 , mam2 , mat1-Mc , mat1-Mi , mat2-Pc , mat2-Pi , mei2 , rgs1
ste20-3(unknown) affecting mei2 , ste11
ste6Δ affecting mam2
sty1Δ affecting cgs2
tor1Δ affecting ecl1 , mei2 , rum1 , ste11
tor2+[Overexpression] affecting mei3 , ste11
tsc1Δ affecting fnx1 , mei2
tsc2Δ affecting fnx1 , isp5
zfs1Δ affecting mam2 , mat2-Pi
+ increased cellular glutathione level during nitrogen starvation
ggt2+[Overexpression]
+ increased level of DNA replication gene mRNA during nitrogen starvation
ssp2Δ
+ increased level of translation gene mRNA during nitrogen starvation
ssp2Δ
+ increased protein level during cellular response to nitrogen starvation
cdr1-34(unknown) ,   cdr1-37(unknown) ,   cdr1-54(unknown) ,   cdr1-76(unknown) ,   cdr1-82(unknown) ,   cdr2-67(unknown) ,   cdr2-96(unknown) ,   cdr2-97(unknown)
cyr1Δ affecting ste11
gaf1Δ affecting ste11
gap1Δ affecting ras1 (GTP+)
nmt1-cig2-III(unknown)[Overexpression] affecting cig2
pka1Δ affecting mug14 , ste11
+ increased protein level during mitotic G1 cell cycle arrest in response to nitrogen starvation
srw1::ura4(disruption) affecting cdc13
+ increased RNA level during nitrogen starvation
cyr1Δ affecting ste11
gaf1Δ affecting ste11
gcn5Δ affecting mei2 , ste11
mei1-B102(unknown) affecting mei2
mei2-B71(unknown) affecting mei2
mei3-N3(unknown) affecting mei2
mei4+[Overexpression] affecting spo6
msa1Δ affecting mam2 , mei2 , ste11
pab1Δ affecting mei2 , ste11
pac2Δ affecting ste11
pka1Δ affecting fbp1 , ste11
ppa2Δ affecting mei2 , ste11
prr1-D418N(aa) affecting mam2 , mei2 , ste11
ras1-val17(G17V aa) affecting mat1-Mi , mat2-Pi
rgs1Δ affecting mam2
rhb1-V17A(aa) affecting inv1
rpl3202+[Overexpression] affecting ste11
sds23+[Overexpression] affecting ste11
sng1-(G159T nt) affecting mat2-Pc , mat3-Mi
ste11-CORE2(CCC(-2642)TGA) affecting ste11
sum3+[Overexpression] affecting ste11
taf12-5A(S217A,T218A,S220A,T221A,T283A aa) affecting mei2 , ste11
tsc1Δ affecting inv1
tsc2Δ affecting inv1
wee1-50(G850E aa) affecting ste11
+ increased RNA level during nitrogen starvation in h+ cells
map1+[Overexpression] affecting map2 , map3 , map4
+ increased RNA level during nitrogen starvation in h- cells
map1+[Overexpression] affecting sxa2
+ RNA absent from cell during nitrogen starvation
byr1Δ affecting fus1 , mam2
byr2Δ affecting fus1
cgs2-1(unknown) affecting mei2
gpa2Δ affecting res1
map1-A83(unknown) affecting map3
map1-mutant(unknown) affecting mat2-Pc
map1Δ affecting map2 , map3 , map4
mat1-McΔ affecting mfm1 , mfm2 , mfm3
mat2-Pc-(unknown) affecting map3
mei1-B102(unknown) affecting mei3
mei4Δ affecting spo6
pac2+[Overexpression] affecting ste11
pat1+[Overexpression] affecting mei2
prr1::ura4(disruption)[Null] affecting mei2 , ste11
ras1Δ affecting mam2 , mfm1 , mfm2 , mfm3
rhb1-V17A(aa) affecting mei2
sme2-5'(509-1562 Δnt) affecting mei4 , ssm4
sme2-DSRless(A1274G,A1467G,A1485G,A1501G,A1527G,A1538G,A1551G,A1560G nt) affecting mei4 , ssm4
ste11-(unknown) affecting mfm1 , mfm2 , mfm3 , res1
ste11-mutant(unknown) affecting fus1
ste8-mutant(unknown) affecting mat2-Pi
sty1Δ affecting ste11
tsc2Δ affecting mei2
wis1Δ affecting ste11
Multi-locus phenotype annotations for FYPO:0004139 and its descendants
Cell
Show details ...
Filters:
+ decreased protein level during cellular response to nitrogen starvation
par1Δ wee1-50(G850E aa) affecting rum1
pka1Δ rst2Δ affecting mug14
+ decreased RNA level during nitrogen starvation
byr1+[Overexpression] byr2Δ affecting mam2
byr1Δ byr2+[Overexpression] affecting mam2
byr1Δ byr3+[Overexpression] affecting mam2
byr1Δ ras1-val17(G17V aa)[Overexpression] affecting mam2
byr1Δ spk1+[Overexpression] affecting mam2
byr2Δ byr3+[Overexpression] affecting mam2
byr2Δ gpa1+[Overexpression] affecting mam2
byr2Δ ras1-val17(G17V aa)[Overexpression] affecting mam2
byr2Δ spk1+[Overexpression] affecting mam2
byr3+[Overexpression] gpa1Δ affecting mam2
byr3+[Overexpression] ras1Δ affecting mam2
gpa1+[Overexpression] ras1Δ affecting mam2
gpa1Δ ras1-val17(G17V aa)[Overexpression] affecting mam2
lsk1Δ ste11-D5'-UTR((-2141)-(-4)) affecting ste11
pka1Δ rst2Δ affecting ste11
ras1-val17(G17V aa)[Overexpression] ras1Δ affecting mam2
ras1Δ spk1+[Overexpression] affecting mam2
+ increased protein level during cellular response to nitrogen starvation
cyr1Δ tor2+[Overexpression] affecting ste11
gap1Δ map3-dn9(311-365 Δaa) affecting ras1 (GTP+)
gap1Δ rgs1Δ affecting ras1 (GTP+)
mug14Δ pka1Δ affecting ste11
+ increased RNA level during nitrogen starvation
byr1+[Overexpression] gpa1Δ affecting mam2
byr1+[Overexpression] ras1Δ affecting mam2
byr2+[Overexpression] gpa1Δ affecting mam2
byr2+[Overexpression] ras1Δ affecting mam2
cyr1Δ tor2+[Overexpression] affecting ste11
gcn5Δ rhb1-V17A(aa) affecting ste11
gcn5Δ tor2-L1310P(aa) affecting mei2 , ste11
gcn5Δ tsc1Δ affecting ste11
gcn5Δ tsc2Δ affecting ste11
+ RNA absent from cell during nitrogen starvation
pcr1Δ pka1Δ affecting ste11
Mastodon