Last updated: 2025-02-19 429030 annotations 4730 curated publications
Gene: SPNCRNA.2243
Gene symbol
(none)
Product
non-coding RNA
Feature type
lncRNA gene
Systematic ID
SPNCRNA.2243
Product size
201 nt
Genomic location
I, 579016-578816 (201nt) Source ...
Genome browser
Transcript details
Key:
 
UTR
 
exon
lncRNA SPNCRNA.2243.1
Location: 579016-578816 (201nt), chromosome I reverse strand     Product size: 201 nt
 
Sequence
Display sequence of these gene parts:
bases upstream of gene start
bases downstream of gene end
>SPNCRNA.2243.1 length:201 includes:exons
TGATTCTTTTGCATGTAGCAGTTCCAAAGTGTATTGATTGGCATCATTTTCGGTTCCTTCGTTATCCCTTTTGGATTTCTCGAAACTAATGTTTTCATCTAAAGTTTTAGATTTTTGTTTCAAATCATCAAGTTGAGCTTGAAGAGATCCGAGAACTGACTCTCTTGAACGTTTAGCATCGGAGGGAAAAGACCAGTAGTA
External references
Sequence Resources RNAcentral URS000230E06E Non-coding RNA sequence database
Sequence resources NCBI SPNCRNA.2243 Query all NCBI databases
Sequence resources Ensembl SPNCRNA.2243 Genome browser
Strain and reagents National BioResource Project (NBRP) SPNCRNA.2243 Strains and clones
Strain and reagents Image Data Resource SPNCRNA.2243 Microscopy data
Expression Gene Expression Omnibus SPNCRNA.2243 GEO profiles
Expression pombeTV (v1) SPNCRNA.2243 Tiling array & Illumina sequencing profiles
Expression pombeNcTV (pombeTV v2) SPNCRNA.2243 Illumina RNA sequencing profiles
Expression Bähler Expression viewer SPNCRNA.2243 RNA expression during the cell cycle
Expression Bähler Expression viewer SPNCRNA.2243 RNA expression during stress
Expression Bähler Expression viewer SPNCRNA.2243 RNA expression during meiosis
Expression Bähler Expression viewer SPNCRNA.2243 RNA expression during mating
Promoters Eukaryotic Promoter Database SPNCRNA.2243 Experimentally validated promoters
Literature
Sort by: Publication gene count | Authors | Year: Ascending / Descending
Details Genes
Long noncoding RNA repertoire and targeting by nuclear exosome, cytoplasmic exonuclease, and RNAi in fission yeast.
Atkinson SR et al. RNA 2018 Sep;24(9):1195-1213 PMID:29914874 Curated details ...
8
Mastodon